View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9675_low_30 (Length: 272)
Name: NF9675_low_30
Description: NF9675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9675_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 47661882 - 47661693
Alignment:
| Q |
18 |
gattgccatggagatcaggagaatattagaggaatgtttgatgagaaggactcttgcagctcatgtagattatatctatactcagaaaatcatatcatcc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47661882 |
gattgccatggagatcaggagaatattagaggaatgtttgatgagaaggactcttgcagct---------tatatctatactcagaaaatcatatcatcc |
47661792 |
T |
 |
| Q |
118 |
atggaatgacaatccatcacatgcatttagaatccaaataacttaataatataaataaatcaaagttataaacaagtaaaaaacatattgtccctatag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47661791 |
atggaatgacaatccatcacatgcatttagaatccaaataacttaataatataaataaatcaaagttataaacaagtaaaaaacatattgtccctatag |
47661693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University