View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9675_low_35 (Length: 255)
Name: NF9675_low_35
Description: NF9675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9675_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 43376254 - 43376027
Alignment:
| Q |
1 |
taactctgtgggaaacaaaacaagaaatagactcaaatgtgtttttgagaattctctacgttaatgtaatgcaaaatcgaaacgaataaaatttgnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43376254 |
taactctgtgggaaacaaaacaagaaatagactcaaatgtgtttttgagaattctctacgttaatgtaatgcaaaatcgaaacgaataaaatttgttttt |
43376155 |
T |
|
| Q |
101 |
nnnnc--------ctagttgtcaaaaacacgggaatgacactgtttaccttttctttaacttaacgccacgtgttctaaggtaaccacgttgataattga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43376154 |
tttttttttttttctagttgtcaaaaacacgggaatgacactgtttaccttttctttaacttaacgccacgtgttctaaggtaaccacgttgacaattga |
43376055 |
T |
|
| Q |
193 |
ccttcgaactcaccctaccagatcagat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43376054 |
ccttcgaactcaccctaccagatcagat |
43376027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University