View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9675_low_36 (Length: 255)
Name: NF9675_low_36
Description: NF9675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9675_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 252
Target Start/End: Complemental strand, 43376482 - 43376249
Alignment:
| Q |
19 |
acaacagttatattcaaatatcaatagttattatggaattgaaagacacaaacnnnnnnntaataatgattttgttacaaacatgaataagagagaggga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43376482 |
acaacagttatattcaaatatcaatagttattatggaattgaaagacacaaacaaaaaataaataatgattttgttacaaacatgaataagagagaggga |
43376383 |
T |
 |
| Q |
119 |
gatggagggtcttacttgtgatgataagaatgtgaaattgtaacagcaatggttgaaattattaaaaaagaatgattacgtagaatgcagtgattgatta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43376382 |
gatggagggtcttacttgtgatgataagaatgtaaaattgtaacagcaatggttgaaattattaaaaaagaatgattacgtagaatgcagggattgatta |
43376283 |
T |
 |
| Q |
219 |
gtgggaattaaggtagatcgggaactccaaactc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
43376282 |
gtgggaattaaggtagatcgggaactcctaactc |
43376249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University