View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9676_low_11 (Length: 265)
Name: NF9676_low_11
Description: NF9676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9676_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 6e-80; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 8000174 - 7999945
Alignment:
| Q |
19 |
cagtggacttcccaattccatttgtcccaaccaaaccaagcacttgccccggtctgggaaccggcaacctacaattacaattacaattcttcgattggat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8000174 |
cagtggacttcccaattccatttgtcccaaccaaaccaagcacttgccccggtctgggaaccggcaacctgcaattacaattacaattcttcgattggat |
8000075 |
T |
 |
| Q |
119 |
taaaaagcttaaaaacataaaaacataagt----nnnnnnnnnnnnnnnnnnctgtgaagcttaaaggtattaggaccatatctatgagtggtatctttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8000074 |
taaaaagcttaaaaacataaaaacataagtcacaacacacacacacacacacctgtgaagcttaaaggtattaggaccatatctatgagtggtatctttg |
7999975 |
T |
 |
| Q |
215 |
tccaaattctttggcaagttgataatttcg |
244 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
7999974 |
tccaaattttttggcaagttgataatttcg |
7999945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 19 - 106
Target Start/End: Complemental strand, 51515267 - 51515180
Alignment:
| Q |
19 |
cagtggacttcccaattccatttgtcccaaccaaaccaagcacttgccccggtctgggaaccggcaacctacaattacaattacaatt |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||| |
|
|
| T |
51515267 |
cagtcgacttcccaattccatttgtcccaaccaaaccaagcacttgccccggcctgggaaccggcaacctgcaattacaattataatt |
51515180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 19 - 148
Target Start/End: Original strand, 7908406 - 7908526
Alignment:
| Q |
19 |
cagtggacttcccaattccatttgtcccaaccaaaccaagcacttgccccggtctgggaaccggcaacctacaattacaattacaattcttcgattggat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
7908406 |
cagtggacttcccaattccatttgtcccgaccaaaccaagcacttgccccggcatgggaaccggcaacc------tgcaattacaattcttggattggaa |
7908499 |
T |
 |
| Q |
119 |
taaaaagcttaaaaacataaaaacataagt |
148 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
7908500 |
taaaaagc---aaaacataaaaacataagt |
7908526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 167 - 242
Target Start/End: Complemental strand, 51515109 - 51515034
Alignment:
| Q |
167 |
ctgtgaagcttaaaggtattaggaccatatctatgagtggtatctttgtccaaattctttggcaagttgataattt |
242 |
Q |
| |
|
||||| |||||||| ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51515109 |
ctgtgtagcttaaaagtattaggaccgtatctatgagtggtatctttgtccaaatcctttggcaagttgataattt |
51515034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 7908541 - 7908589
Alignment:
| Q |
167 |
ctgtgaagcttaaaggtattaggaccatatctatgagtggtatctttgt |
215 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7908541 |
ctgcgaagcataaaggtattaggaccatatctatgagtgatatctttgt |
7908589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 167 - 240
Target Start/End: Original strand, 1304386 - 1304459
Alignment:
| Q |
167 |
ctgtgaagcttaaaggtattaggaccatatctatgagtggtatctttgtccaaattctttggcaagttgataat |
240 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| || |||||||||||||||| |||||||||||||| |
|
|
| T |
1304386 |
ctgtgtagcttaaaagtattaggaccatatctatgagttgtttctttgtccaaattctccggcaagttgataat |
1304459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 89
Target Start/End: Original strand, 1304217 - 1304287
Alignment:
| Q |
19 |
cagtggacttcccaattccatttgtcccaaccaaaccaagcacttgccccggtctgggaaccggcaaccta |
89 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||| |||||| || |||| |||||||||| |
|
|
| T |
1304217 |
cagtggacttcccaattccatttttccctaccaaaccaagcactttccccggcctcggaatcggcaaccta |
1304287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University