View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9676_low_13 (Length: 243)
Name: NF9676_low_13
Description: NF9676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9676_low_13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 11 - 243
Target Start/End: Original strand, 49082471 - 49082723
Alignment:
| Q |
11 |
ccatcaatctctggtttttcattacttacccaaatcatggaccatcactattgcaaaaacattcctctcataagtatg--------------------tt |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
49082471 |
ccatcaatctctggtttttcattacttacccaaatcatggaccatcacaattgcaaaaacattcctctcataagtatgttatgttatgttatgttatgtt |
49082570 |
T |
|
| Q |
91 |
atgtctgaactaattaaataacttccttcttcatgtttcctcattacatcatgtatgtaaatgtaatttgcagtgatgtcttctcaagattcagttagca |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49082571 |
atgtctgaactaattaaataacttccttcttcatgtttcctcattacatcatgtatgtaaatgtaatttgcagtgatgtcttctcaagattcagttagca |
49082670 |
T |
|
| Q |
191 |
ctgtattcaaattcatgctcaacggggctgtcgattttctcattaaaccagtt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49082671 |
ctgtattcaaattcatgctcaacggggctgtcgattttctcattaaaccagtt |
49082723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University