View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9676_low_15 (Length: 235)
Name: NF9676_low_15
Description: NF9676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9676_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 12 - 215
Target Start/End: Original strand, 46617320 - 46617523
Alignment:
| Q |
12 |
agtttcgtggttagaaattcagcccaaggtaaataagaggagaatcagaagtttgaagttaaacccctgcatacataacacaacgttcataccaacttag |
111 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46617320 |
agtttagtggctagaaattcagcccaaggtaaataagaggagaatcagaagtttgaagctaaacccctgcatacataacacaacgttcataccaacttaa |
46617419 |
T |
|
| Q |
112 |
ttatgttcacggagacacatacacgataattagtaacttgcttaaatgaatattttgcgagttagatatttttcccttctaactacaaagtaacactcac |
211 |
Q |
| |
|
||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46617420 |
ttatgtttacggaaacatatacacgataattagtaacttgcttaaatgaatattttgcgagttagatatttttcccttctaactacaaagtaacactcac |
46617519 |
T |
|
| Q |
212 |
cact |
215 |
Q |
| |
|
|||| |
|
|
| T |
46617520 |
cact |
46617523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University