View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9676_low_4 (Length: 344)
Name: NF9676_low_4
Description: NF9676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9676_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 8 - 326
Target Start/End: Original strand, 50392422 - 50392736
Alignment:
| Q |
8 |
tggtggtaagcccctttaattctacagtatggaagtcaaactttttcattctcagtatgcttttatcatgtcgttgagttcatatgattgctcattatgg |
107 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50392422 |
tggtggtaagctcctttaattctacagtatggaagtcaaactttttaattctcagtatgcttttatcatgtcgttgagttcatatgattgctcattatgg |
50392521 |
T |
 |
| Q |
108 |
acacactgctcttttcatattactacttttagttttattcatgcnnnnnnngcaaccttttgtaaatgtgatgttggaggtattcctgatcatcagcagc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50392522 |
acacactgctcttttcatattactacttttaattttattcctgcttttat-gcaaccttttgtaaatgtgatgttggaggtattcct---catcagcagc |
50392617 |
T |
 |
| Q |
208 |
agttgagttaataaattactaattaaattttttgtttatcaaattttgttggtttcaaacacaacttgtatccatgacaatcttgttgactaaaagatat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50392618 |
agttgagttaataaattactaattaaattttttatttatcaaattttgttggtttcaaacacaacttgtatccatgacaatcttgttgactaaaagatat |
50392717 |
T |
 |
| Q |
308 |
atgtataagagatagaact |
326 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
50392718 |
atgtataagagatagaact |
50392736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University