View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9677_high_3 (Length: 437)
Name: NF9677_high_3
Description: NF9677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9677_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 409; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 409; E-Value: 0
Query Start/End: Original strand, 20 - 432
Target Start/End: Complemental strand, 54615164 - 54614752
Alignment:
| Q |
20 |
gtaggagtctcccatatatcaaaaacattctcttcactatgaagtgcaaaaagcctatcccctccaatggaaaaatcacatattgacccaccatagcttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54615164 |
gtaggagtctcccatatatcaaaaacattctcttcactatgaagtgcaaaaagcctatcccctccaatggaaaaatcacatattgacccaccatagcttc |
54615065 |
T |
|
| Q |
120 |
gtcttaacctagacgttaaaacccattcagggccacagaacactgagatacaatcattcatggaagagaaaagttgtccaccatgcaatgccaatttagg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54615064 |
gtcttaacctagacgttaaaacccattcagggccacagaacactgagatacaatcattcatggaagagaaaagttgtccaccatgcaatgccaatttagg |
54614965 |
T |
|
| Q |
220 |
gtaacaaggttcctcaggcatcttccctttcatcaacctacttctagaactccacctcacactgttagcagcagaacttctcaaatccatgaaacccaat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54614964 |
gtaacaaggttcctcaggcatcttccctttcatcaacctacttctagaactccacctcacactgttagcagcagaacttctcaaatccatgaaacccaat |
54614865 |
T |
|
| Q |
320 |
tcctcaaactcattcaccacacaaattgaactattatcctccattgcaattgcatccctcacccttttctcatccacagccaaagtagaacctacatcag |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54614864 |
tcctcaaactcattcaccacacaaattgaactattatcctccattgcaattgcatccctcacccttttctcatccacagccaaagtagcacctacatcag |
54614765 |
T |
|
| Q |
420 |
accaacaccaaac |
432 |
Q |
| |
|
||||||||||||| |
|
|
| T |
54614764 |
accaacaccaaac |
54614752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University