View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9677_low_26 (Length: 259)
Name: NF9677_low_26
Description: NF9677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9677_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 24 - 244
Target Start/End: Complemental strand, 104764 - 104544
Alignment:
| Q |
24 |
ttgcgccaataagtttcaaactcaaaagggtttgcttaatggatacaagcacaccttttgatgttgttaccatttttactattctcttattatcataccc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
104764 |
ttgcgccaataagtttcaaactcaaaagggtttgcttaatggatacaagcacaccttttgatgttgttaccatttttactattctcttattatcataccc |
104665 |
T |
|
| Q |
124 |
tttcgatatagcaaatgcaaactctgaaggtaagtaaagtacagtctcttttgttttgattgatacatacaaacaagcatacacataatctgaaagaaag |
223 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
104664 |
ttttgatatagcaaatgcaaactctgaaggtaagtaaagtacagtctcttttgttttgattgatacatacaaacaagcatacacataatctgaaagaaag |
104565 |
T |
|
| Q |
224 |
aatcttttgttttgatgttct |
244 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
104564 |
aatcttttgttttgatgttct |
104544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University