View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9678_low_2 (Length: 317)
Name: NF9678_low_2
Description: NF9678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9678_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 196 - 305
Target Start/End: Original strand, 10298848 - 10298957
Alignment:
| Q |
196 |
gccaatacatatagtacataaccaccaacaatttctaacaagatggtacatttttgttcttctcattaaacagattttgacgttttactgcgtctaacat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10298848 |
gccaatacatatagtacataaccaccaacaatttctaacaagatggtacatttttgttcttctcattaaacagattttgacgttttactgcgtctaacat |
10298947 |
T |
|
| Q |
296 |
ggaccaccaa |
305 |
Q |
| |
|
|||||||||| |
|
|
| T |
10298948 |
ggaccaccaa |
10298957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 19 - 159
Target Start/End: Original strand, 10298671 - 10298811
Alignment:
| Q |
19 |
tctagaacagagacataaaactttatttaagttttttcactct--cttctttgcaaagaatacagctaaaaaccataaataagcttccaagacatgctac |
116 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10298671 |
tctagaacagaggcataaaactttattcaagttttttcactctctcttctttgcaaagaatacagctaaaaaccataaataagcttccaagacatgctac |
10298770 |
T |
|
| Q |
117 |
ggctctctgtcttcactgaactgtatgaggggagaccggttac |
159 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10298771 |
gg--ttctgtcttcactgaactgtatgaggggagaccggttac |
10298811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University