View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9679_low_22 (Length: 307)
Name: NF9679_low_22
Description: NF9679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9679_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 52444979 - 52445275
Alignment:
| Q |
1 |
aaggcatagagctgcgtgaaagtagtatggagcctcccatctaagctggcaaagaggcctctcaccgcatcttcagtgagtgcttgctgctgcagattca |
100 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52444979 |
aaggcatagagctgcgcgaaagtagcatggagcctcccatctaagctggcaaagaggcctctcaccgcatcttcagtgagtgcttgctgctgcagattca |
52445078 |
T |
 |
| Q |
101 |
aaacttggttctgcagctccgcaatcttcgcaacatgagcaagaaccttagcaatcctaacacaaagataaggtgttgcactgccacgcctgtgcatgac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52445079 |
aaacttggttctgcagctccgcaatcttcgcaacatgagcacggaccttagcaatcctaacacaaagataaggtgttgcactgccacgcctgtgcatgac |
52445178 |
T |
 |
| Q |
201 |
cctaatttgcatcatgcactgctccacggacttgtcagccatgtcatgctcgtacacaatgtcattcttgatgacatccatatgatattcatgctca |
297 |
Q |
| |
|
| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52445179 |
cttaatttgcatcatgcactgctccacgtacttgtcagccatgtcatgctcgtacataatgtcattcttgatgacatccatatgatatccatgctca |
52445275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University