View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9679_low_31 (Length: 265)
Name: NF9679_low_31
Description: NF9679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9679_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 14 - 249
Target Start/End: Complemental strand, 813005 - 812771
Alignment:
| Q |
14 |
agggttaacttcatttctttttcatatcttcaacatgtttaattgggttgtgttttgatcttgtcaaatctcaatttatttgannnnnnnatgaatgatt |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||| |
|
|
| T |
813005 |
agggttagcttcatttctttttcatatcttcaacatgtttaattgggttgtgttttcatcttgtcaaatctcaatttatttgatttttttatcaatgatt |
812906 |
T |
 |
| Q |
114 |
tgtgggtttcaaacttacaatttcatttttgtgtttttcatgtcatgttgtaagtaaaatgaatttgatttccattaccttcttcaatcttctccctctt |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
812905 |
tgtgggtttcaaacttacaatttgatttttgtgtttttcatgtcatgttgtaagtaaaatgaatttgatttccattaccttcttc-atcttctccctctt |
812807 |
T |
 |
| Q |
214 |
gcgcagtcaaagaactattttgattttgtaataaat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
812806 |
gcgcagtcaaagaactattttgattttgtaataaat |
812771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University