View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9679_low_33 (Length: 265)
Name: NF9679_low_33
Description: NF9679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9679_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 36684798 - 36684562
Alignment:
| Q |
18 |
tagattatagaggatctctcataatcttaaaaaatttctctcttaatcgaacagtccaaagccatctagcttcccaatgaaattgtggtaaaggatttgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36684798 |
tagattatagaggatctctcataatcttaaaaattttctctcttaatcgaacagtccaaagccatctagcttcccaatgaaattgtggtaaaggatttgg |
36684699 |
T |
 |
| Q |
118 |
gttgtataaaaaagtgttacccttcatctcattaccttgttgactctatctaaatagcatatttgtattgcttacaatccatagaaatgattgacatata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36684698 |
gttgtataaaaaagtgttacccttcatctcattaccttgttgactctatctaaatagcatatttgtattgcttacaatccatagaaatgattgacatata |
36684599 |
T |
 |
| Q |
218 |
taacttaatttgttatggttggaattcacagatctct |
254 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36684598 |
taacttaatttgttatggttggaatccacagatctct |
36684562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University