View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9681_high_5 (Length: 249)
Name: NF9681_high_5
Description: NF9681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9681_high_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 249
Target Start/End: Complemental strand, 23806498 - 23806264
Alignment:
| Q |
19 |
aaagtcccatctaaaggcaataaagagagcttatggaccatcactatgggaacaattggtgaaaagttgtaagccaaacgtgagataatcagtgaagtgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23806498 |
aaagtcccatctaaaggcaataaagagagcttatggaccatcactatgggaacaattggtgaaaagttgtaagccaaacgtgagataatcagtgaagtgc |
23806399 |
T |
 |
| Q |
119 |
tttttgtggagcatgtgtggatatttttataaaagcagatcttaataa--tttataaattataaagtccaaatggtggt--taatatcatcctttttagc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23806398 |
tttttgtggagcatgtgtggatatttttataaaagcagatcttaataatgtatataaattataaagtccaaatggtggttataatatcatcctttttagc |
23806299 |
T |
 |
| Q |
215 |
atgttttccataatcaagtactcactttcccttgg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
23806298 |
atgttttccataatcaagtactcactttcccttgg |
23806264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University