View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9681_low_12 (Length: 241)
Name: NF9681_low_12
Description: NF9681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9681_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 19 - 226
Target Start/End: Complemental strand, 44013239 - 44013031
Alignment:
| Q |
19 |
gtcagatggtaaaagaccacaaaaatatttgataagttaggactcggcaagtgttt-gtgaatttcactactaaactcttctgnnnnnnnnnnnnnnnnn |
117 |
Q |
| |
|
|||||||||||||| ||| || ||| |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
44013239 |
gtcagatggtaaaaaaccgcagaaacatttgataagttaggactcggcaagtgttttgtgaatttcactactagactcttctgaaaaggaaaaaaaatca |
44013140 |
T |
 |
| Q |
118 |
nnnncttgttactagtactttatttaataataagacaattctagtcaacttgaaatttgagaatttatttatggttatttattgaaggacattttattag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44013139 |
aaaacttgttactagtactttatttaataataagacaattctagtcaacttgaaatttgagaatttatttatggttatttattgaaggacattttattag |
44013040 |
T |
 |
| Q |
218 |
ttccctatg |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
44013039 |
ttccctatg |
44013031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University