View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9681_low_16 (Length: 213)
Name: NF9681_low_16
Description: NF9681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9681_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 4664947 - 4664767
Alignment:
| Q |
16 |
gagacaatgatatagtgagaggaagtttggaaagtatagcttgggatactaggaaaaagtgtttgaagatcaacctatttgttaacatgtgcaaaattgc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4664947 |
gagacaatgatatagtgagaggaagtttggaaagtatagcttgggatactaggaaaaagtgtttgaagatcaacctatttgttaacaagtgcaaaattgc |
4664848 |
T |
 |
| Q |
116 |
agattgtttagtgatgtgtccgtgttctatatatggacacggcagagttatgcagagttattgtggaagaaggccggacat |
196 |
Q |
| |
|
|||||||||||||||||||||||||| | || ||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4664847 |
agattgtttagtgatgtgtccgtgttttttacatggacacgacagagttatgcagagttgttgtggaagaaggccggacat |
4664767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 64
Target Start/End: Complemental strand, 42294620 - 42294572
Alignment:
| Q |
16 |
gagacaatgatatagtgagaggaagtttggaaagtatagcttgggatac |
64 |
Q |
| |
|
||||||||| || |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
42294620 |
gagacaatggtactgtgaaaggaagtttggaaagtattgcttgggatac |
42294572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University