View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9682_high_11 (Length: 226)
Name: NF9682_high_11
Description: NF9682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9682_high_11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 2 - 226
Target Start/End: Complemental strand, 35836380 - 35836156
Alignment:
| Q |
2 |
aaaacaacccccaaatcgtaacttcatgcaaataatcctcacaagtcacatgattaacataaattctttgcaaattattgagtctccgataagttagtca |
101 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35836380 |
aaaacaacccccaaatcgtaatttcatacaaataatcctcacaagtcagaagattaacataaattctttgcaaattattgaatctccgataagttagtca |
35836281 |
T |
 |
| Q |
102 |
ttcgaccggtaataaagatgacgtgactgttaactgttcacgttacatcaccaacttgcatttatctcgatgccacatcgcggattgattttctttacta |
201 |
Q |
| |
|
|| || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||| | |
|
|
| T |
35836280 |
tttgatcggtaatagagatgacgtgactgttaactgttcacgttacatcaccaacttgcatttatctcgatgctacatcgcggactgattttctctacca |
35836181 |
T |
 |
| Q |
202 |
cgtcacatggattaatttgctcttt |
226 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35836180 |
cgtcacatggattaatttgctcttt |
35836156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University