View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9682_low_25 (Length: 244)
Name: NF9682_low_25
Description: NF9682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9682_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 21 - 231
Target Start/End: Complemental strand, 32127682 - 32127476
Alignment:
| Q |
21 |
gagggaaggtgagtttgaagagagggaggtggttcccatctcttttcttcttagaatgaatatggctgaggaatgaagataacatactgtgtggttatat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32127682 |
gagggaaggtgagtttgaagagagggaggtggttcccatctcttttcttcttagaatgaatatggctgaggaatgaagataacatactgtgtggttatat |
32127583 |
T |
|
| Q |
121 |
ttttctcatccctttttatatcattatcctgacatggggccaaccaaccaatagaagacatttcagaacaggatgtagtgcatgcaaactcatccaaaaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32127582 |
ttttctcatccctttttatatcattatcctgacatggggccaa----ccaatagaagacatttcagaacaggatgtagtgcatgcaaactcatccaaaaa |
32127487 |
T |
|
| Q |
221 |
ttactctctgc |
231 |
Q |
| |
|
||||||||||| |
|
|
| T |
32127486 |
ttactctctgc |
32127476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University