View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9682_low_33 (Length: 211)
Name: NF9682_low_33
Description: NF9682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9682_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 44997063 - 44997235
Alignment:
| Q |
19 |
acatatttatacaagtatagaatagcaacttaattattaccgtttgtagagcatgccaaaaactgttcttctaactggattgagctcttccactgctttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44997063 |
acatatttatacaagtatagaatagcaacttaatta---ccgtttgtagagcatgccaaaaactgttcttctaactggattgagctcttccactgctttc |
44997159 |
T |
|
| Q |
119 |
ttgatacctgaaacatataatcttgaatgagttatgtactaaattgtaatgaaataaataatttttgtgcagaatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44997160 |
ttgatacctgaaacatataatcttgaatgagttatgtactaaattgtaatgaaataaataatttttgtgcagaatt |
44997235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 62 - 133
Target Start/End: Complemental strand, 38767342 - 38767271
Alignment:
| Q |
62 |
ttgtagagcatgccaaaaactgttcttctaactggattgagctcttccactgctttcttgatacctgaaaca |
133 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||| || | | |||||||||||||||||||| ||||| |
|
|
| T |
38767342 |
ttgtagagcatgccaaaaactgttctcctcactggatttagttgtgccactgctttcttgatacctaaaaca |
38767271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University