View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9684_low_19 (Length: 311)
Name: NF9684_low_19
Description: NF9684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9684_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 6 - 295
Target Start/End: Original strand, 36922676 - 36922965
Alignment:
| Q |
6 |
agacactcctgagttgaaatatatatttggccattgttcccatcaatatccaaacaagtaccaaattgagcttccggttttggaaaaagttgcactctac |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36922676 |
agacactcctgagttgaaatatatatttggccattgttcccatcaatatccaaacaagtaccaaattgagcttccggttttgggaaaagttgcactctac |
36922775 |
T |
|
| Q |
106 |
gatataccaaatatgattgccatttgtccagaaaactaccatgcaacatgctcgtctttgcaacttcttgtcatgaacgatgttagtctatcagtgaata |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36922776 |
gatataccaaatatgattgccatttgtccagaaaactaccatgcaacatgctcgtctttgcaacttcttgtcatgaacgatgttagtctatcaatgaata |
36922875 |
T |
|
| Q |
206 |
atttgatggttgattctgtagccacacactccgatcttagttctgataaaacagtacaactccttttctccctctcattgtctttcttat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36922876 |
atttgatggttgattctgtagccacacactccgatcttagttctgataaaacagtaaaactccttttctccctctcattgtctttcttat |
36922965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University