View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9684_low_23 (Length: 295)
Name: NF9684_low_23
Description: NF9684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9684_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 16 - 273
Target Start/End: Complemental strand, 8552403 - 8552145
Alignment:
| Q |
16 |
actgacaacttgtacggcaagtttggttttcnnnnnnn-ctcattgtctgattcatattattaatatcttcttatgctatagtatagagatagagataca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8552403 |
actgacaacttgtacggcaagtttggttttcttttttttctcattgtctgattcatattattaatatcttcttatgctatagtatagagatagagataca |
8552304 |
T |
|
| Q |
115 |
gctttattttatgtatctctgagcattttatgtgtgtgtaaatgacagaaggatatgactaagaaattgcataaaaataaatagggcaagcaacaggtcc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8552303 |
gctttattttatgtatctctgagcattttatgtgtgtgtaaatgacagaaggatatgactaagaaattgcataaaaataaatagggcaagcaacaggtcc |
8552204 |
T |
|
| Q |
215 |
gttaaaggagagaaattaaaaaagcatagaattagactgtgcaaactgtgtctgtctgt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8552203 |
gttaaaggagagaaattaaaaaagcatagaattagactgtgcaaactgtgtctgtctgt |
8552145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University