View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9684_low_32 (Length: 239)
Name: NF9684_low_32
Description: NF9684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9684_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 40734198 - 40734418
Alignment:
| Q |
1 |
gcaatttttcagtacttttcaatttgacgggttcaaatacttctcattaataagaaattttcttggtaacctatgttgatgagatttaatatttgnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40734198 |
gcaatttttcagtacttttcaatttgacgggttcaaatacttctcattaataagaaattttcttggtaacctatgttgatgagatttaatatttg--ttt |
40734295 |
T |
 |
| Q |
101 |
nnagttacaccacgtatattttgggttacaccctaaattgatnnnnnnntacccccaatctttttcaaattttcaattattagcttttgtcttccttctc |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40734296 |
ttagttacaccacgtgtattttgggttacaccctaaattgataaaaaaatacccctaatctttttcaaatttttaattattagcttttgtcttccttctc |
40734395 |
T |
 |
| Q |
201 |
tactgtactcttcttcatcctat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40734396 |
tactgtactcttcttcatcctat |
40734418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University