View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9685_low_14 (Length: 268)
Name: NF9685_low_14
Description: NF9685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9685_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 5 - 253
Target Start/End: Complemental strand, 42728394 - 42728146
Alignment:
| Q |
5 |
gtttggagttacatgcacatcagttgacatagacataaattcaaacattatccaaatgtgtttttggcaaagtannnnnnnaattattaaaaagtgcaag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42728394 |
gtttggagttacatgcacatcagttgacatagacataaattcaaacattatccaaatgtgtttttggcaaagtatttttttaattattaaaaagtgcaag |
42728295 |
T |
|
| Q |
105 |
ataggttttaggcacacaagtattgagcgacacgtttcatagataaactcaggtgtagatatggtggtgcctataacgacggtagtttacatacatcgtt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42728294 |
ataggttttaggcacacaagtattgagcgacacgtttcatagataaactcaggtgtagatatggtggtgcctataacgacggtagtttacatacatcgtt |
42728195 |
T |
|
| Q |
205 |
cttggtcatatgttataataagttcatttaggaatgtatgttatgtatt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42728194 |
cttggtcatatgttataataagttcatttaggaatgtatgttatgtatt |
42728146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University