View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9685_low_7 (Length: 329)
Name: NF9685_low_7
Description: NF9685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9685_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 13 - 183
Target Start/End: Complemental strand, 9027352 - 9027187
Alignment:
| Q |
13 |
gagaaaaagagaaagcacgctcataaaggtaaaaaacaaacaaatctcgacaactttaatttgtctttgttttgataaagacatacattgtttaattaat |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9027352 |
gagaaaaagaggaagcacgctcataaaggtaaaaaacaaacaaatctcgacaacttt-----gtctttgttttgataaagacatacattgtttaattaat |
9027258 |
T |
 |
| Q |
113 |
ctatatacattttatcactacttcatgttttgcaaatgtatggctaatcatataatatgatatggtccctc |
183 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9027257 |
ctatatacattttatcactatttcatgttttgcaaatgtatggctaatcatataatatgatatggtccctc |
9027187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University