View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9686_high_15 (Length: 241)

Name: NF9686_high_15
Description: NF9686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9686_high_15
NF9686_high_15
[»] chr7 (2 HSPs)
chr7 (124-228)||(20227913-20228017)
chr7 (14-53)||(20227803-20227842)


Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 124 - 228
Target Start/End: Original strand, 20227913 - 20228017
Alignment:
124 aagccattagaagattttgttgtgttcggtggtatcgaggcttgaggtttgaggaggaggagaactggagtaactagtaagagagatcacgtgtaagaca 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
20227913 aagccattagaagattttgttgtgttcggtggtatcgaggcttgaggtttgaggaggaggagaactggagtaactagcaagagagatcacgtgtaagaca 20228012  T
224 caggt 228  Q
    |||||    
20228013 caggt 20228017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 53
Target Start/End: Original strand, 20227803 - 20227842
Alignment:
14 ggatgaaggtggaggatcgggtaggggaatggattgtgct 53  Q
    |||||||||||||||||||||| |||||||||||||||||    
20227803 ggatgaaggtggaggatcgggttggggaatggattgtgct 20227842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University