View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9686_high_16 (Length: 238)

Name: NF9686_high_16
Description: NF9686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9686_high_16
NF9686_high_16
[»] chr5 (2 HSPs)
chr5 (19-68)||(8628480-8628529)
chr5 (150-226)||(8628565-8628641)


Alignment Details
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 8628480 - 8628529
Alignment:
19 gttcacagcaaaaatattgtattgtgacaatgatattaatgacttgctat 68  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||    
8628480 gttcacaacaaaaatattgtattgtgacaatgatattaatgacttgctat 8628529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 150 - 226
Target Start/End: Original strand, 8628565 - 8628641
Alignment:
150 atcttttacacaatcgaatcaacacaaaacataaaacatagtgtatgaaattttatggttaaccatagtagtataat 226  Q
    ||||| |||||||||||||||| | |||||| | ||| ||||||||||||||||||||||||||||| || ||||||    
8628565 atcttctacacaatcgaatcaatataaaacacacaacgtagtgtatgaaattttatggttaaccataataatataat 8628641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University