View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9686_low_13 (Length: 326)
Name: NF9686_low_13
Description: NF9686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9686_low_13 |
 | |
|
| [»] scaffold0171 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 300
Target Start/End: Original strand, 36734263 - 36734568
Alignment:
| Q |
1 |
gaaattagggacaggtttgattctatgatggagaggattatcaaggagcatcaagaagtaaggaggaggagaaaggaagttggtggaggagaaggtcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36734263 |
gaaattagggacaggtttgattctatgatggagaggattatcaaggagcatcaagaagtaaggaggaggagaaaagaagttggtggaggagaaggtcaaa |
36734362 |
T |
|
| Q |
101 |
ttaaggatctacttgatattttattggatattcttgaagatgagagctctgaaatcaaattgaaaatggagaacataaaagccttcatcttggtaagtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36734363 |
ttaaggatctacttgatattttattggatattcttgaagatgagagctctgaaatcaaattgaaaatggagaacataaaagccttcatcttggtaagtga |
36734462 |
T |
|
| Q |
201 |
caagtgactcagatttacattatatgcac------tcgtattttgattttgtttttaaaatataattggcgaacttgaaacatgaaacttcttatcttaa |
294 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36734463 |
caagtgactcagatttacattatatgcactctagatcgtattttgattttgtttttaaaatataattggcgaacttgaaacatgaaacttcttatcttga |
36734562 |
T |
|
| Q |
295 |
tctaac |
300 |
Q |
| |
|
|||||| |
|
|
| T |
36734563 |
tctaac |
36734568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 101 - 163
Target Start/End: Original strand, 24587 - 24649
Alignment:
| Q |
101 |
ttaaggatctacttgatattttattggatattcttgaagatgagagctctgaaatcaaattga |
163 |
Q |
| |
|
|||||||| | ||||||||||| ||||| |||| ||||||||||||| |||||| ||||||| |
|
|
| T |
24587 |
ttaaggatttgcttgatattttgttggaaattcatgaagatgagagcagtgaaataaaattga |
24649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University