View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9686_low_17 (Length: 293)
Name: NF9686_low_17
Description: NF9686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9686_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 9e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 26 - 241
Target Start/End: Complemental strand, 43469743 - 43469528
Alignment:
| Q |
26 |
gtaacgtgatcatgtcttatttattttcaattatgttttttcttaaaattactacaaaatttgagtagcattctnnnnnnnnnttatcgacaaagtatta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
43469743 |
gtaacgtgatcatgtcttatttattttcaattatgttttttcttaaaattactacaaaatttgagtagcatt-ttaaaaaaaattatcgacaaagtatta |
43469645 |
T |
 |
| Q |
126 |
aatgtcaagcgagtannnnnnnn-agaatccacctatatggacaaagtgcacgaactaatccgataatatacctgaggtgaccggtaacaaatcggatcc |
224 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43469644 |
aatgtcaagcaagtatttttttttagaatccacctatatcgacaaagtgaacgaactaatccgataatatacctgaggtgaccggtaacaaatcggatcc |
43469545 |
T |
 |
| Q |
225 |
aatttaaaatcaatgac |
241 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
43469544 |
aatctaaaatcaatgac |
43469528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University