View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9686_low_18 (Length: 273)
Name: NF9686_low_18
Description: NF9686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9686_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 271
Target Start/End: Complemental strand, 25334538 - 25334285
Alignment:
| Q |
18 |
cttctaagtgtccctcgtgtaatagacgcttttgcgcgaagtgcaaagttccatggcatggaggaatgagttgtgagagattccaagcaatcaaaaggaa |
117 |
Q |
| |
|
||||||||||||| |||||| | ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25334538 |
cttctaagtgtccttcgtgtcacagacgcttttgcgcgaagtgcaaagttccgtggcatggaggaatgagttgtgagagattccaagcaatcaaaaggag |
25334439 |
T |
|
| Q |
118 |
taacccaaatgatttggataccatatttttggagttggctaagagtgaaatgtggcaaagatgtccacattgctctatgtttgtaaagagagttcatgga |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25334438 |
taaccctaatgatttggataccatatttttggagttggctaagagtgaaatgtggcaaagatgtccacattgctctatgtttgtaaagagagttcatgga |
25334339 |
T |
|
| Q |
218 |
tgtagttacattcaatgcaggtttgttatgtatcccatctcctttgctactcct |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
25334338 |
tgtagttacattcaatgcaggtttgttatgtatcctatctctcttgctaatcct |
25334285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 47 - 159
Target Start/End: Complemental strand, 25345584 - 25345472
Alignment:
| Q |
47 |
ttttgcgcgaagtgcaaagttccatggcatggaggaatgagttgtgagagattccaagcaatcaaaaggaataacccaaatgatttggataccatatttt |
146 |
Q |
| |
|
||||| || |||||||||||||||||||||| |||||||| |||| ||| ||||||| | | ||||||||| || |||||||||||||| | ||||| |
|
|
| T |
25345584 |
ttttgtgcaaagtgcaaagttccatggcatgcaggaatgaattgtcagaaattccaacaatttaaaaggaatgacaaaaatgatttggataagaaatttt |
25345485 |
T |
|
| Q |
147 |
tggagttggctaa |
159 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
25345484 |
tggtgttggctaa |
25345472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University