View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9686_low_29 (Length: 241)
Name: NF9686_low_29
Description: NF9686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9686_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 124 - 228
Target Start/End: Original strand, 20227913 - 20228017
Alignment:
| Q |
124 |
aagccattagaagattttgttgtgttcggtggtatcgaggcttgaggtttgaggaggaggagaactggagtaactagtaagagagatcacgtgtaagaca |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20227913 |
aagccattagaagattttgttgtgttcggtggtatcgaggcttgaggtttgaggaggaggagaactggagtaactagcaagagagatcacgtgtaagaca |
20228012 |
T |
 |
| Q |
224 |
caggt |
228 |
Q |
| |
|
||||| |
|
|
| T |
20228013 |
caggt |
20228017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 53
Target Start/End: Original strand, 20227803 - 20227842
Alignment:
| Q |
14 |
ggatgaaggtggaggatcgggtaggggaatggattgtgct |
53 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20227803 |
ggatgaaggtggaggatcgggttggggaatggattgtgct |
20227842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University