View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9686_low_32 (Length: 238)
Name: NF9686_low_32
Description: NF9686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9686_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 8628480 - 8628529
Alignment:
| Q |
19 |
gttcacagcaaaaatattgtattgtgacaatgatattaatgacttgctat |
68 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8628480 |
gttcacaacaaaaatattgtattgtgacaatgatattaatgacttgctat |
8628529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 150 - 226
Target Start/End: Original strand, 8628565 - 8628641
Alignment:
| Q |
150 |
atcttttacacaatcgaatcaacacaaaacataaaacatagtgtatgaaattttatggttaaccatagtagtataat |
226 |
Q |
| |
|
||||| |||||||||||||||| | |||||| | ||| ||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
8628565 |
atcttctacacaatcgaatcaatataaaacacacaacgtagtgtatgaaattttatggttaaccataataatataat |
8628641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University