View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9686_low_42 (Length: 206)

Name: NF9686_low_42
Description: NF9686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9686_low_42
NF9686_low_42
[»] chr7 (1 HSPs)
chr7 (1-154)||(49082847-49083000)


Alignment Details
Target: chr7 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 49083000 - 49082847
Alignment:
1 tacatgaggctcactannnnnnncactgcattcaatatttttgtgtgtggaagccacggaaccactagaatgattgcttgcagcattgttttctgcagca 100  Q
    ||||||||||||||||       |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
49083000 tacatgaggctcactatttttttcactgcattcaatatttttgtgtgtggaagccacagaaccactagaatgattgcttgcagcattgttttctgcagca 49082901  T
101 acatcaagtttattctgtggaaatgttatgttttgaggaggcatgataatctgt 154  Q
    ||||||||||||||||||||||||||||| ||||||||||||||| ||||||||    
49082900 acatcaagtttattctgtggaaatgttatattttgaggaggcatggtaatctgt 49082847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University