View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9687_low_17 (Length: 241)
Name: NF9687_low_17
Description: NF9687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9687_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 4 - 224
Target Start/End: Complemental strand, 2273881 - 2273661
Alignment:
| Q |
4 |
tggagaagcagagactctcacaagaagaaaaggaaaataaattttcagtgtcgtcaaattacagtaacaatactgtgtgggattgtggaagtacacttta |
103 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2273881 |
tggagaaacagaaactctcacaagaagaaaaggaaaataaattttcagtgtcgtcaaattacagtaacaatactgtgtgggattgtggaagtacacttta |
2273782 |
T |
 |
| Q |
104 |
tgattcctttgaactcaactccttcaaaaaccaacttgactcagccatagctagttcaaacattttaaatagaacactttccatgtctcatttaccggag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2273781 |
tgattcctttgaactcaactccttcaaaaaccaacttgactcagccatagctagttcaaacattttaaatagaacactttccatgtctcatttaccggag |
2273682 |
T |
 |
| Q |
204 |
cgtcgagtcacagtacttcag |
224 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
2273681 |
cgtcaagtcacagtacttcag |
2273661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University