View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_high_12 (Length: 321)
Name: NF9688_high_12
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 12888999 - 12888783
Alignment:
| Q |
1 |
ttatgcttggtatggcaataacttgtaataaaaccggtttcttgaagggatcctttcaaaataaagagctggattggacaggcttttttctgcattttcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12888999 |
ttatgcttggtatggcaataacttgtaataaaaccggtttcttgaagggatcctttcaaaataaagagctggattggacaggct-ttttctgcattttcg |
12888901 |
T |
 |
| Q |
101 |
tattttctacacgtcacatgatgcctagaaagacttgtcaaactcaaatctaata---tttggtttggtgtac-ttctattttaacttcttcaagttcga |
196 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||| | |
|
|
| T |
12888900 |
tattttctacatgtcacatgatgcctagaaagacttgtcaaactcaaatctaatatcttttggtttggtgtactttctattctaacttcttcaagttcta |
12888801 |
T |
 |
| Q |
197 |
ccacagaagcaaagctaa |
214 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
12888800 |
ccacataagcaaagctaa |
12888783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 12891349 - 12891277
Alignment:
| Q |
1 |
ttatgcttggtatggcaataacttgtaataaaaccggtttcttgaagggatcctttcaaaataaagagctgga |
73 |
Q |
| |
|
||||||||| || |||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
12891349 |
ttatgcttgttaaggcaataacttgtattaaaaccggttcattcaagggatcctttcaaaataaagagctgga |
12891277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 306
Target Start/End: Complemental strand, 12888721 - 12888691
Alignment:
| Q |
276 |
cccataaagtcacaacacaaagcaacaatgt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12888721 |
cccataaagtcacaacacaaagcaacaatgt |
12888691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University