View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_high_2 (Length: 447)
Name: NF9688_high_2
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 285; Significance: 1e-159; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 18 - 345
Target Start/End: Original strand, 7165033 - 7165361
Alignment:
| Q |
18 |
ggatgtaaaattaacaaatgtaattttgctttgtcaatgacggcagaaatggtttgctttcgtgtttctcaatttcactaagttgagttgtttttgcttc |
117 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7165033 |
ggatgtaaaattaacacatgtatttttgctttgtcaatgacggcataaatggtttgctttcgtgtttctcaatttcactaagttgagttgtttttgcttc |
7165132 |
T |
|
| Q |
118 |
aacaataattttatgtaccagtatgtgggaagataaatatttgatcttgtctcttagaaaacacaaccaatgtttaccatttacgatctcattttttact |
217 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7165133 |
aacaataatttcatgtaccattatgtgggaagataaatatttgatcttgtctcttataaaacacaaccaatgtttaccatttaccatctcattttttact |
7165232 |
T |
|
| Q |
218 |
taaggg-gtttctcaatacctcaccttctatgccaatctataggtcttctcctagtgatttaataccttcaaaggaccactccctgcaactgcaagcaca |
316 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7165233 |
taagggagtttctcaatacctctccttctatgccaatctataggtcttctcctagtgatttaacaccttcaaaggaccactccctgcaactgcaagcaca |
7165332 |
T |
|
| Q |
317 |
tcattacaaccttgaaattctcatctata |
345 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7165333 |
tcattacaaccttgaaattctcatctata |
7165361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 346 - 433
Target Start/End: Original strand, 7165388 - 7165475
Alignment:
| Q |
346 |
gataacatgaattaatgaatagatcgcacaatatgtcagaccccctcttaacgtcttatctaataacataaggatcttttatttgatg |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7165388 |
gataacatgaattaatgaatagatcgcacaatatgtcagaccctctcttaacgtcttatctaataacataaggatcttttatttgatg |
7165475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University