View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_high_24 (Length: 236)
Name: NF9688_high_24
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 43856004 - 43855787
Alignment:
| Q |
1 |
tatggatgatctcatcgcgaaacagatgcgtgtttcgcgacaagataatccacattgtgaattggtttcatttgatcgcaattgtgcaaatgcttttcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43856004 |
tatggatgatctcatcgcgaaacagatgcgtgtttcgcgacaagagaatccacattgtgaattggtttcatttgatcgcgattgtgcaaatgcttttcag |
43855905 |
T |
|
| Q |
101 |
cattatgtcaatgagaatcttgcttttgctatgaaaaggggtgggtttatgtatggtactgttactgaagaaggaaaggttgaggtgaattttatatatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43855904 |
cattatgtcaatgagaatcttgcttttgctgtgaaaaggggtgggtttatgtatggtactgttactgaagaaggaaaggttgaggtgaattttatatatg |
43855805 |
T |
|
| Q |
201 |
aacctccgcaacaaggtt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43855804 |
aacctccgcaacaaggtt |
43855787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University