View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_high_25 (Length: 229)
Name: NF9688_high_25
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 7 - 204
Target Start/End: Complemental strand, 35918116 - 35917930
Alignment:
| Q |
7 |
taaacaaattcgacataaaagataataaattatgtgggacctcaatcgctaaagaatttgtttagtctcaattaatgtccaataaaatttattaaaattc |
106 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
35918116 |
taaacaaattcaacataaaagataataaattatgtgggacctcaatcgctaaagagattgtt-agtctcaattaatgtccaataaaaattattaaagttc |
35918018 |
T |
|
| Q |
107 |
atggaattaggaattttcatatacttgggttgcaggagtcttacgtataatcttatttatgcgcagttgaaaattgtctatataattggattgtttga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35918017 |
atggaattaggaattttcatatacttgggttgcaggagtcttacgta----------tatgcgcagttgaaaattgtctatataattggattgtttga |
35917930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University