View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_high_5 (Length: 405)
Name: NF9688_high_5
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 151 - 400
Target Start/End: Original strand, 4257151 - 4257400
Alignment:
| Q |
151 |
cgcagcgaaaagaagagtgtggggtctttaatttgcgaagttttagtaccttgttgatacatatgattttttgactgagaagatgaattcggagccatca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4257151 |
cgcagcgaaaagaagagtgtggggtctttaatttgcgaagttttagtaccttgttgatacatatgattttttgactgagaagatgaattcggagccatca |
4257250 |
T |
 |
| Q |
251 |
atgtcggtttgtgatgaacattccgaagaagaatttgggaagccagtgatagaaaatggagactcaactactgttgatccgcctaagtttaagcgccgga |
350 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4257251 |
atgtcggtttgtgatgaacattctgaagaagaattagggaagccagtgatagaaaatggagactcaactattgttgatccgcctaagtttaagcgccgga |
4257350 |
T |
 |
| Q |
351 |
aagtttctgctgttcgtgattttccggaagaatgtggaccctttgcttct |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
4257351 |
aagtttctgctgttcgtgattttccggaagaatgtggaccgtttggttct |
4257400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 38 - 74
Target Start/End: Original strand, 4257044 - 4257080
Alignment:
| Q |
38 |
cttgtggttttataactagtaatttcatgtttatatt |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4257044 |
cttgtggttttataactagtaatttcatgtttatatt |
4257080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 303 - 362
Target Start/End: Original strand, 2511113 - 2511172
Alignment:
| Q |
303 |
aaaatggagactcaactactgttgatccgcctaagtttaagcgccggaaagtttctgctg |
362 |
Q |
| |
|
||||||| |||||||||| |||||||| |||||||||||||||| ||||| ||||||||| |
|
|
| T |
2511113 |
aaaatggggactcaactattgttgatcggcctaagtttaagcgctggaaaatttctgctg |
2511172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University