View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_low_17 (Length: 361)
Name: NF9688_low_17
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 5e-44; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 253 - 347
Target Start/End: Original strand, 4499382 - 4499476
Alignment:
| Q |
253 |
gcaattatgttgcaagttatggtgatgaaaaaatggggtgctgttcataattggtttggtcaaaataaaaaccaaattaatgggatggtaatgat |
347 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4499382 |
gcaattatgttgcaagttattgtgatgaaaaaatggggtgctgttcataattggtttggtcaaaataaaaaccaaattaatgggatggtaatgat |
4499476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 280 - 347
Target Start/End: Complemental strand, 13233719 - 13233652
Alignment:
| Q |
280 |
aaaaaatggggtgctgttcataattggtttggtcaaaataaaaaccaaattaatgggatggtaatgat |
347 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| |||||||||| || |||| ||||||||| |
|
|
| T |
13233719 |
aaaaaatggggtgatgttcataattggttcagtcaaaacgaaaaccaaataaacgggacggtaatgat |
13233652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University