View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_low_28 (Length: 307)
Name: NF9688_low_28
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 19 - 289
Target Start/End: Complemental strand, 43082316 - 43082046
Alignment:
| Q |
19 |
cagagacgacttagggtgtgtgaaaagtgctaatgacctaagcaacaatcacaaccttatgctgcaagctagattacaagaattcaggaaacagtatcca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082316 |
cagagacgacttagggtgtgtgaaaagtgctaatgacctaagcaacaatcacaaccttatgctgcaagctagattacaagaattcaggaaacagtatcca |
43082217 |
T |
 |
| Q |
119 |
catgcagtcatagtttatgctgattacttcaatgcctaccgtactgtgatgaagaatccaagcaagtatggattcaaagatgtgttcagtgtctgctgtg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43082216 |
catgcagtcatagtttatgctgattacttcaatgcctaccgtactgtgatgaagaatccaagcaagtatggattcaaagatttgttcagtgtctgctgtg |
43082117 |
T |
 |
| Q |
219 |
gatcaggagaacctccttacaacttcactgtgtttgaaacttgtggtacacctaatgctactgtctgcact |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082116 |
gatcaggagaacctccttacaacttcactgtgtttgaaacttgtggtacacctaatgctactgtctgcact |
43082046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University