View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_low_30 (Length: 288)
Name: NF9688_low_30
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 112 - 273
Target Start/End: Complemental strand, 40614583 - 40614424
Alignment:
| Q |
112 |
aataaataaatgtggcgaaacacctgtgacttgtcgaaggggaaaattatagagttgagnnnnnnntaaatgtggccaaaagggtgtgtgccttgtagaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
40614583 |
aataaataaatgtggcgaaacacctgtgacttgtcgaaggggaaaattatagagttgagaaaaaaataaatgtggccaaaagggtgtg--ccttgtagaa |
40614486 |
T |
 |
| Q |
212 |
gaggaaaattataaaacctgctactaaaacaagaaattaccctcaaacccaaccgaaatagg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40614485 |
gaggaaaattataaaacctgctactaaaacaagaaattaccctcaaacccaaccgaaatagg |
40614424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 112 - 269
Target Start/End: Complemental strand, 40610622 - 40610468
Alignment:
| Q |
112 |
aataaataaatgtggcgaaacacctgtgacttgtcgaaggggaaaattatagagttgagnnnnnnntaaatgtggccaaaagggtgtgtgccttgtagaa |
211 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||| |||| |||||||||||| ||||||||||||||| |
|
|
| T |
40610622 |
aataaataaatgtcgcgaaacacatgtgacttgtcgaaggggaaaattagagagttgagaaaaaaataaacgtggccaaaagg--gtgtgccttgtagaa |
40610525 |
T |
 |
| Q |
212 |
gaggaaaattataaaacctgctactaaaacaagaaattaccctcaaacccaaccgaaa |
269 |
Q |
| |
|
| ||||||||||| ||||||| ||||||| || ||||||||||||||||||||||||| |
|
|
| T |
40610524 |
ggggaaaattatacaacctgccactaaaataa-aaattaccctcaaacccaaccgaaa |
40610468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University