View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_low_31 (Length: 288)
Name: NF9688_low_31
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 45 - 271
Target Start/End: Complemental strand, 35818078 - 35817854
Alignment:
| Q |
45 |
aacactgctggtattgcatgtaggtcttttaataggtacatattaacccacctatcctttctcgaaaacaaaaaatatatatgtggtacacaggttcgga |
144 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | || |||||||||||||||||| |
|
|
| T |
35818078 |
aacactgctgatattgcatgtaggtcttttaataggtacatactaacccacctatcctttctcgaaaacaaaaaaaaaat--gtggtacacaggttcgga |
35817981 |
T |
|
| Q |
145 |
ctgggatgagctcgaacatattagacaagctattggatttctggtatctatatttttcactagataccatcttgcatatattaggaacgtagagaggaga |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35817980 |
ctgggatgagctcgaacatattagacaagctattggatttctggtatctatatttttcactagataccatcttgcatagattaggaacgtagagaggaga |
35817881 |
T |
|
| Q |
245 |
aatggaaaaatgatggaaacagaaatt |
271 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35817880 |
aatggaaaaatgatggaaacagaaatt |
35817854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 145 - 195
Target Start/End: Original strand, 47703591 - 47703641
Alignment:
| Q |
145 |
ctgggatgagctcgaacatattagacaagctattggatttctggtatctat |
195 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47703591 |
ctgggatgagctcaaacatattaggcaagctattggatttctggtatctat |
47703641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University