View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_low_34 (Length: 269)
Name: NF9688_low_34
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_low_34 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 7 - 269
Target Start/End: Original strand, 36774298 - 36774563
Alignment:
| Q |
7 |
gaagcagagaggaagttgctaactacggaaatttcaaagaactatggtggtcggttgaagtggaagcattttgttctatcacacttttgttcaccactaa |
106 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36774298 |
gaagcaaagaggaagttgctaactacggaaatttcaaagaactatggtggtcggttgaagtggaagcattttgttctatcacacttttgttcacccctaa |
36774397 |
T |
 |
| Q |
107 |
ttt---attaaactcaaaaacagttttgtttagaataaattacactctcatctcctccgaataattgtttaaattacactatcctctcttcttatatcct |
203 |
Q |
| |
|
||| ||||||||||||||||||||||| |||| |||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774398 |
ttttttattaaactcaaaaacagttttgtctagagtaaattacactctcttcttctcggaataattgtttaaattacactatcctctcttcttatatcct |
36774497 |
T |
 |
| Q |
204 |
ctccattcttatgcaaaacatgttagaaaaaattacattcttctttctcttttgtttttatcttct |
269 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
36774498 |
ctccattcttatacaaaacatgttagaaaaaattacactcttctttctcggttgtttttatcttct |
36774563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University