View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_low_41 (Length: 249)
Name: NF9688_low_41
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 42925732 - 42925495
Alignment:
| Q |
1 |
tttgggatcagagttgtgaggaagagcctgtgatggagagggtggaatctggaagagatataagggtgaagatgtttgagaaactgagcaaagagaactc |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42925732 |
tttgggatcagagttgtgaagaagagcctgtgatggagagggtggaatctggaagagatataagggtgaagatgtttgagaaactgagcaaagagaactc |
42925633 |
T |
|
| Q |
101 |
ttttaatggatcgggtatgggttcaggttcaggttcgggtgaagttgttgaggatccggatgttgggtgggtttcggagctggtgagccctttcttgggt |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42925632 |
ttttaatggatcgggcatgggttcaggttcaggtttgggtgaagttgttgaggatccggatgttgggtgggtttcggagctggtgagccctttcttgggt |
42925533 |
T |
|
| Q |
201 |
gattgaatgttgatgatttcattttgggtttgtcgtct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42925532 |
gattgaatgttgatgatttcattttgggtttgtcgtct |
42925495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 94
Target Start/End: Original strand, 34340800 - 34340891
Alignment:
| Q |
3 |
tgggatcagagttgtgaggaagagcctgtgatggagagggtggaatctggaagagatataagggtgaagatgtttgagaaactgagcaaaga |
94 |
Q |
| |
|
||||||||||||||||| || |||||| | |||||||| || || |||||||||||| |||| ||||||||||||||| | |||||||| |
|
|
| T |
34340800 |
tgggatcagagttgtgaagaggagcctataatggagagagttgagagtggaagagatattagggctaagatgtttgagaaattaagcaaaga |
34340891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University