View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_low_47 (Length: 240)
Name: NF9688_low_47
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_low_47 |
 |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 12002849 - 12002629
Alignment:
| Q |
1 |
tagaaaattggttcaacgaaaaattgatatatttagactgaattttaaaccatatacattaacttttattgatcaannnnnnncttataaacaaattcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
12002849 |
tagaaaattggttcaacgaaaaattgatatatttagactgaattttaaaccatatacattaacttttattgatcaatttttttcttataaacgaattcga |
12002750 |
T |
 |
| Q |
101 |
aaggagtagtaaatgactcttcaaaattccaccggatacacaaagttgattctcttttccatagacaactagactttttctatgcactaattaaggaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12002749 |
aaggagtagtaaatgactcttcaaaaa--caccggatacacaaagttgattctcttttccatagacaactagactttttctatgcactaattaaggaaat |
12002652 |
T |
 |
| Q |
201 |
ggggctgcttattaaccatatat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12002651 |
ggggctgcttattaaccatatat |
12002629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 72
Target Start/End: Complemental strand, 14525 - 14472
Alignment:
| Q |
19 |
aaaaattgatatatttagactgaattttaaaccatatacattaacttttattga |
72 |
Q |
| |
|
|||||||||| ||| || | |||||||||||||||||| ||||||||||||||| |
|
|
| T |
14525 |
aaaaattgatgtatctatattgaattttaaaccatatatattaacttttattga |
14472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University