View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_low_49 (Length: 240)
Name: NF9688_low_49
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_low_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 7003420 - 7003654
Alignment:
| Q |
1 |
tgtattttgaagtgaaaaatgggttctgctctcgtgagaaattgcgagtatctttgtaggtttgtaatacccttttgtactgtaaagttaacaaaaat-a |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7003420 |
tgtattttgaagtgaaaaatgggttctgctctcgtgagaaattgcgagtatctttgtaggtttgtaatacccttttgtactgtaaagttaacaaaaataa |
7003519 |
T |
|
| Q |
100 |
attaatagggagatttgggcagattcagattatgttttatgtctttatgt----------tgatgatcatgaaatgaaataacctggaagcaaaatggaa |
189 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7003520 |
attaatagggaaatttgggcagattcagattatgttttatgtctttgtttactctttatgtgatgatcatgaaatgaaataacctggaagcaaaatggaa |
7003619 |
T |
|
| Q |
190 |
ctgtattataacaagtaaaaatataattggaaatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7003620 |
ctgtattataacaagtaaaaatataattggaaatt |
7003654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University