View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9688_low_49 (Length: 240)

Name: NF9688_low_49
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9688_low_49
NF9688_low_49
[»] chr2 (1 HSPs)
chr2 (1-224)||(7003420-7003654)


Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 7003420 - 7003654
Alignment:
1 tgtattttgaagtgaaaaatgggttctgctctcgtgagaaattgcgagtatctttgtaggtttgtaatacccttttgtactgtaaagttaacaaaaat-a 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
7003420 tgtattttgaagtgaaaaatgggttctgctctcgtgagaaattgcgagtatctttgtaggtttgtaatacccttttgtactgtaaagttaacaaaaataa 7003519  T
100 attaatagggagatttgggcagattcagattatgttttatgtctttatgt----------tgatgatcatgaaatgaaataacctggaagcaaaatggaa 189  Q
    ||||||||||| |||||||||||||||||||||||||||||||||| | |          ||||||||||||||||||||||||||||||||||||||||    
7003520 attaatagggaaatttgggcagattcagattatgttttatgtctttgtttactctttatgtgatgatcatgaaatgaaataacctggaagcaaaatggaa 7003619  T
190 ctgtattataacaagtaaaaatataattggaaatt 224  Q
    |||||||||||||||||||||||||||||||||||    
7003620 ctgtattataacaagtaaaaatataattggaaatt 7003654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University