View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_low_51 (Length: 239)
Name: NF9688_low_51
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_low_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 21 - 120
Target Start/End: Complemental strand, 36775113 - 36775014
Alignment:
| Q |
21 |
aatgtataaaaattaagctttttatattgatggatattattaattattttagatgatctttcaataaatatatgtgcgttgttcaaataattatgaatat |
120 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
36775113 |
aatgtacaaaaattaaactttttatattgatggatattattaattattttagatgacctttcaataaatatatgtgagtttttcaaataattatgaatat |
36775014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 128 - 198
Target Start/End: Complemental strand, 36774825 - 36774755
Alignment:
| Q |
128 |
tacccctgtttttatattatataaataccttacttctcacaattatctgtatgaataggaacagcatacag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774825 |
tacccctgtttttatattatataaataccttacttctcacaattatctgtatgaataggaacagcatacag |
36774755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University