View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9688_low_58 (Length: 223)
Name: NF9688_low_58
Description: NF9688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9688_low_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 210
Target Start/End: Complemental strand, 24719123 - 24718930
Alignment:
| Q |
17 |
caatcacgttggttttcttgtgttaagaacatctcctttggaatcatttcttgccaagccgattcatcggatggtgtcacatgaacatgagactgataca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24719123 |
caatcacgttggttttcttgtgttaagaacatctcctttggaatcatttcttgccaagccgattcatcggatggtgtcacatgaacatgagactgataca |
24719024 |
T |
|
| Q |
117 |
tcatcacttctttcttccatgtctcattctttgatgccattaattcagttcgcaacgtatgcgattgaggcaaattatttatgcattctctgct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24719023 |
tcatcacttctttcttccatgtctcattctttgatgccattaattcagttcgcaacgtatgcgattgaggcaaattatttatgcattctttgct |
24718930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 118 - 153
Target Start/End: Complemental strand, 24688716 - 24688681
Alignment:
| Q |
118 |
catcacttctttcttccatgtctcattctttgatgc |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
24688716 |
catcacttctttcttccatgtctcattctttgatgc |
24688681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 118 - 154
Target Start/End: Complemental strand, 24728223 - 24728187
Alignment:
| Q |
118 |
catcacttctttcttccatgtctcattctttgatgcc |
154 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24728223 |
catcacttctttcttccatgtttcattctttgatgcc |
24728187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University