View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9689_high_2 (Length: 400)
Name: NF9689_high_2
Description: NF9689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9689_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 180 - 387
Target Start/End: Complemental strand, 46939999 - 46939792
Alignment:
| Q |
180 |
tagtaattttagggtgcaactcaaaaggacaaattttagtgctgccagtttatgtttattaagagaaagatttgtcctcaagtactcaactagcttgcat |
279 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46939999 |
tagtaattttagggtacaactcaaaaggacaaattttagtgctgccagtttatgtttattaagagaaagatttgtcctcaagtactcaactagcttgcat |
46939900 |
T |
|
| Q |
280 |
taattaatatctttattcaaaacgacaaggaacttttttcttttgtgattcagttgcttttccaccatctcaaagcaagattttccttgtttagatgttt |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46939899 |
taattaatatctttattcaaaacgacaaggaacttttttcttttgtgattcagttgcttttccaccatctcaaagcaaggttttccttgtttagatgttt |
46939800 |
T |
|
| Q |
380 |
ttctttct |
387 |
Q |
| |
|
|||||||| |
|
|
| T |
46939799 |
ttctttct |
46939792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 19 - 176
Target Start/End: Complemental strand, 46940522 - 46940351
Alignment:
| Q |
19 |
ggtgcaacatgagaatggttatgtgaagcaatacgatcacgtggagatgcaagtcaagacacaagcgtgcaatccgtcgagaaaaattcatcttgcttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46940522 |
ggtgcaacatgagaatggttatgtgaagcaatacgatcacgtggagatgcaagtcaagacacaagcgtgcaatccgtcgagaaaaattcatcttgcttgt |
46940423 |
T |
|
| Q |
119 |
gtaatagtgc---------tctcaactatcc-----tttaatcctttcttcactctcctagctagccagaaa |
176 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46940422 |
gtaatagtgctctctcaagtctcaactatcctttaatttaatcctttcttcactctcctagctagccagaaa |
46940351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 25 - 77
Target Start/End: Complemental strand, 35105105 - 35105054
Alignment:
| Q |
25 |
acatgagaatggttatgtgaagcaatacgatcacgtggagatgcaagtcaaga |
77 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
35105105 |
acatgagaatg-ttatgtgaagcaatacgatcaagtggagatgtaagtcaaga |
35105054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 109 - 156
Target Start/End: Complemental strand, 35105042 - 35104993
Alignment:
| Q |
109 |
tcttgcttgtgtaatagtgctctc--aactatcctttaatcctttcttca |
156 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
35105042 |
tcttgcttgtgtaatagtgctctctcaactattctttaatcctttcttca |
35104993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University