View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9689_low_7 (Length: 345)
Name: NF9689_low_7
Description: NF9689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9689_low_7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 19 - 345
Target Start/End: Complemental strand, 43151040 - 43150717
Alignment:
| Q |
19 |
agagaagtcactatgctgatgtataccatgttggttacagtttgcacagataagtaagcataagttactcgttgataaatctctggaagattacatgttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43151040 |
agagaagtcactatgctgatgtataccatgttggttacagtttgcatagataagtaagcataaattactcgttgataaatctctggaagattacatgttg |
43150941 |
T |
 |
| Q |
119 |
gtcaataatgcgatatatctagtatatatagttgccgtggacatcctttaattcgtttcggtagtggtgactatatgctgtagccacaattatactagca |
218 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43150940 |
gtcaataatgcgatatatctag--tgtatagttgccgtggacatcctttaattcgtttcggtagtggtgactatatgctgtagccacaattatactagta |
43150843 |
T |
 |
| Q |
219 |
gctattggaatnnnnnnnnnntaccaagccttcccccttccggtacacgcaaagttagcaacacttaacacgttctctttttgaaggaaactcacgtaaa |
318 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43150842 |
gctattggaa-ataaaaaaaataccaagccttcccccttcctgtacacgcaaagttagcaacacttaacacgttctctatttgaaggaaactcacgtaaa |
43150744 |
T |
 |
| Q |
319 |
tcttctctccgctttcgatgcttattc |
345 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
43150743 |
tcttctctccgctttcgaggcttattc |
43150717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University